Teave

Metoodika tähistuse täpsustamine pärmikasvatusmeetodil

Metoodika tähistuse täpsustamine pärmikasvatusmeetodil


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Ma loen paberit pärmikultuuri ja meetodite kohta, seal öeldakse:

Siis $5$ ml steriilset $M/15 KH_2PO_4$, lisati kaldu,

Mida tähendab M $ / 15 $?


Penicillium: kirjeldus, struktuur ja paljunemine

Penicillium on saprofüütne seen, mida tuntakse tavaliselt sinise või rohelise hallitusena. Raperi ja Thomi (1949) andmetel kuulub perekonda 136 liiki, mis on levinud üle kogu maailma. Neid leidub pinnases, õhus, lagunevatel puuviljadel, juurviljadel, lihal jne.

Imeravimi penitsilliini avastas esmakordselt Sir Alexander Fleming Londoni Sant Mary haiglas 1929. aastal, kui ta töötas bakteriga Staphylococcus aureus, mis põhjustab keemist, karbunkuli, haavade sepsise ja põletushaavu jne. hallitusseente eostega (Penicillium notatum), mis pärast korralikku kasvu põhjustab 5. aureuse surma, näidates enda ümber lüütilist tsooni.

Ta eraldas ja nimetas selle anti-shymikroobse ühendi penitsilliiniks. Hiljem valisid Raper ja Alexander (1945) penitsilliini tootmisel P. crysogenum'i tüve, mis on tõhusam kui P. notatum. Penicilliumi tähtsust on mainitud tabelis 4.6.

Vegetatiivne struktuur Penicillium:

Vegetatiivne keha on mütseel (joon. 4.42A, B). Mütseel on rikkalikult hargnenud vaheseintega, mis koosnevad õhukeseseinalistest rakkudest, mis sisaldavad ühte kuni mitut tuuma (joonis 4.42C). Igal vaheseinal on keskne poor, mille kaudu säilib tsüto- ja hüplasmaatiline järjepidevus.

Mõned seeneniidistikud kasvavad toidumaterjali imamiseks sügavamale substraati ja teised jäävad substraadile ja kasvatavad seeneniidistiku vildi. Varutuit esineb õlikuulikeste kujul.

Paljundamine sisse Penicillium:

Penicillium paljuneb vegetatiivsel, aseksuaalsel ja seksuaalsel teel.

1. Vegetatiivne paljunemine:

See toimub vegetatiivse mütseeli juhuslikul purunemisel kaheks või enamaks fragmendiks. Seejärel kasvab iga fragment eraldi nagu emamütseel.

2. Mittesuguline paljunemine:

Mittesuguline paljunemine toimub üherakuliste, ühetuumaliste, mitteliikuvate eoste abil, konidiofooril moodustuvad koniidid (joon. 4.43).

Konidiofoor areneb püstise haruna mis tahes vegetatiivse mütseeli rakust. Konidiofoor võib olla hargnemata (P. spinulosum, P. thomii) või muutuda erinevalt hargnevaks (P. expansum). Konidiofoori haru (joonis 4.44B) tuntakse ramusena (mitmuses rami), mis muutub hargnevaks, tuntud kui metulae. Iga metula otsas areneb hulk kolvikujulisi phiaide ehk sterigmatasid.

Iga sterigmati otsas areneb hulk basipetaalselt asetsevaid koniidisid (noorem ema lähedal ja vanem sellest eemal). Hargnemata koni&südiofooriga liikidel (P. spinulosum) arenevad sterigmad konidiofoori tipus. Harva (P. claviforme) koonduvad paljud konidiofoorid kokku, moodustades klubikujulise vilja, mida nimetatakse coremiumiks, millest tekivad koremiospooridena tuntud koniidid.

Koniidiumi arengu käigus paisub sterigma ots üles ja selle tuum jaguneb mitootiliselt kaheks tuumaks, millest üks rändab paisunud tippu ja vaheseinaga lõikab paisunud piirkond ema küljest ära ja moodustab ühetuumalise koniidiumi.

Sterigma ots paisub uuesti üles ja sama protseduuri järgi moodustub teine ​​koniidium, mis surub esimese väliskülje poole. See protsess kordub mitu korda ja nii moodustub koniidide ahel.

Koniidid (joonis 4.44C) on struktuurilt ovaalsed, elliptilised või kerajad, sileda, kareda, ehhinulaadise välispinnaga ning erineva värvusega, nagu roheline, kollane, sinine jne.

Pärast küpsemist eralduvad koniidid emast ja hajuvad tuulega. Sobival substraadil nad idanevad (joonis 4.44D), arendades idutoru. Tuum läbib korduvalt mitootilist jagunemist ja kõik tuumad sisenevad idutorusse. Vaheseinte moodustumine jätkub koos idutoru pikenemisega ja lõpuks tekib uus vaheseinte hargnenud seeneniidistik.

3. Seksuaalne paljunemine:

Sugulist paljunemist on uuritud vaid vähestel liikidel (joon. 4.44). See näitab suuri erinevusi isogaamiast (P. bacillosporum), oogaamiast (P. vermiculatum) kuni somatogaamiani (P. brefeldianum). Enamik liike on homotallikud, välja arvatud mõned, näiteks P. luteum, on heterotallikud. Askokarpe moodustub harva. Askokarpide põhjal võib eri perekondadeks liigitada Europenicillium, Talaromyces ja Carpenteles.

Perekond Talaromyces koosneb 15 liigist. Kõik uuritud Talaro­myces'i liigid on homotallikud. Seksuaalse paljunemise käsitlust Talaromyces vermiculatus (= Penicillium vermiculatum) kirjeldas Dangeard (1907). See kiirus näitab oogaamilist sugulise paljunemise tüüpi. Naiste ja meeste suguelundid on vastavalt askogoonium ja antheridium’.

Askogoonium areneb mis tahes vegetatiivse filamendi rakust püstise ühetuumalise ja üherakulise kehana (joonis 4.44E). Seejärel läbib tuum mitu mitootilist jagunemist ja toodab 32 või 64 tuuma (joonis 4.44F).

Antheridium areneb samaaegselt mis tahes naaberhüüfi askogooniumiga (joonis 4.44F). See on ka ühetuumaline ja üherakuline haru, mis keerdub ümber askogooniumi. Antheridiaalse haru apikaalne piirkond katkeb vaheseinaga ja moodustab lühikese, pisut ülespuhutud ühe- ja ebatsellulaarse ja ühetuumalise antheriidiumi (joonis 4.44G).

Pärast nii askogooniumi kui ka antheriidiumi küpsemist paindub antheridiumi ots ja puudutab askogooniumi seina. Ühine sein kokkupuutepunktis lahustub ja kaks tsütoplasma segunevad seejärel.

Antheriidiumi tuum ei migreeru (joonis 4.44H) askogooniumi (Dangeard, 1907). Hiljem toimub tuumade paaritumine askogooniumiks ainult askogooniliste tuumade poolt. Seejärel jaguneb askogoonium vaheseina kaudu paljudeks kahetuumalisteks rakkudeks, mis paiknevad ühekaupa (joonis 4.44H).

Osa ascogo­nium'i kahetuumalistest rakkudest eenduvad välja mitmerakuliste askogeensete hargnenud hüüfide moodustumisega, mille rakud on samuti dikarüootsed (joonis 4.441). Dikarüootse mütseeli apikaalsed rakud paisuvad ja toimivad askuse emarakkudena (joonis 4.44J).

Mõlemad askuse emaraku tuumad läbivad kariogaamiat ja moodustavad diploidse (2n) tuuma (joonis 4.44K). Seejärel läbib tuum esmalt meioosi, seejärel mito&shüüsi, mille tulemusena moodustub 8 tuuma, millest pärast tsütoplasma akumuleerumist moodustub 8 askospoori (joonis 4.44L).

Askogooniumi ja antheriidiumi arenedes takerduvad nendega järk-järgult paljud steriilsed hüüfid ja lõpuks pärast askospooride moodustumist muutub kogustruktuur ümaraks viljakehaks, st kleistoteetsiumiks (joonis 4.44M). Astikud paiknevad kleistotetsiumi sees ebakorrapäraselt. Askospoorid võivad olla kerajad, elliptilised või läätsekujulised, sileda, okastuumalise, lohutatud (joonis 4.44N) või hargnenud välisseinaga nagu tõmberatas külgvaates.

Askospoorid vabanevad askuse ja kleistoteeseina lahustumisel. Askospoor idaneb sobival substraadil, arendades idutoru (joonis 4.440) ja lõpuks mütseeliks nagu ema.


Objekti C atribuudile juurdepääsu punktitähistus on sõnumi saatmine, just nagu sulgudes. See tähendab, et arvestades järgmist:

Kaks viimast rida koostavad täpselt sama. Ainus asi, mis seda muudab, on see, kui atribuudil on määratud atribuut getter ja/või setter, kuid see muudab vaid seda, millist sõnumit saadetakse, mitte seda, kas sõnum saadetakse:

Mõlemad kaks viimast rida kompileeritakse identselt.

Vaadake artiklit Cocoa is My Girlfriend. Asja põhiolemus seisneb selles, et ühe teisele kasutamisele ei kohaldata tulemuslikku karistust.

Kuid tähistus muudab muutujatega toimuva ja muutujatega toimuva nägemise keerulisemaks.

Ainus kord, kui näete jõudluse erinevust, on see, kui te ei märgi omadust "mitteatoomiliseks". Seejärel lisab @synthesize teie atribuudi seadistustele automaatselt sünkroonimiskoodi, hoides selle lõime turvalisena, kuid selle seadistamine ja juurdepääs on aeglasem.

Seetõttu soovite tõenäoliselt määratleda sellise omaduse nagu:

@omadus (mitteatoomiline, säilitama) NSString *myProp

Isiklikult leian, et punktitähistus on üldiselt kasulik sellest seisukohast, et te ei pea mõtlema õigete seadistusmeetodite kirjutamisele, mis pole isegi mitteatomaarsete määrajate jaoks täiesti triviaalne, kuna peate meeles pidama ka vana väärtuse õiget vabastamist. Mallkoodi kasutamine aitab, kuid võite alati teha vigu ja see on tavaliselt korduv kood, mis segab klassid.

Muster, mida tasub meeles pidada: kui määrate seadja ise (selle asemel, et lasta @synthesize'il seda luua) ja teil tekivad väärtuse määramisel muud kõrvalmõjud, peaksite arvatavasti muutma seadja tavaliseks meetodiks, selle asemel et kasutada omaduse tähistust.

Atribuutide semantiline kasutamine näib olevat helistaja jaoks otsene juurdepääs tegelikule väärtusele ja kõik, mis sellest erineb, tuleks seega teha sõnumi saatmise, mitte atribuudile juurdepääsu kaudu (kuigi mõlemad saadavad sõnumeid).


3. Vanad malmist pesupesad

19. ja 20. sajandil otsisid mõned piiritusetehased alternatiive. Nad soovisid kasutada materjale, mida on lihtsam puhastada ja mis pikendavad kasutusiga. Malm oli nende sajandite vastus ja mõnes piiritusetehases näete ikka veel mõnda neist rasketest tagasivooludest.

Malmist pesupesad Alt a Bhaine'is


Patendid

Taustteave ja otsingukriteeriumid

Patent on juriidiline dokument, mis kirjeldab tehnilist teavet. See ülevaade põhineb "patendiperekondadel", mis ühendavad sama põhileiutist kirjeldavad spetsifikatsioonid. Vastupidiselt teistele selleteemalistele ülevaadetele (Gélinas 2009 2010a 2010b) on need seotud patendid esitatud vastavalt varaseimale esitamiskuupäevale, mitte avaldamiskuupäevale. See aitas kindlaks teha seotud leiutiste prioriteedi, jälgida algseid leiutajaid ning hinnata paremini tehnoloogia suundumusi ja leiutajate stiimuleid vastavalt ajale. Selle ülevaate koostamise käigus leiti, et sellistes riikides nagu Saksamaa ja Austria esines esitamiskuupäevade ja avaldamiskuupäevade vahel suuri viivitusi, mõnikord rohkem kui 5 aastat, eriti I ja II maailmasõja ajal aastatel 1914–1918 ja 1939 kuni 1945.

Mitmes patendiametis kontrolliti üldiselt enne patentide vastuvõtmist ja avaldamist pärast 1900. aastat esitatud kirjeldustes avaldatud leiutiste prioriteetsust. Siiski avaldati Suurbritannias (GB) mitteaktsepteeritud patentide spetsifikatsioone kuni 1883. aastani, kuid leiti ühe 1924. aastal välja antud mitteaktsepteeritud GB patendi täielik spetsifikatsioon (GB 192085). GB patendid, mille taotlemise kuupäev oli varasem kui 1916. aastal, tuvastati nii taotlemisaasta (mitte avaldamisaasta) kui ka tagantjärele seerianumbri järgi, võeti kasutusele uus ja pidevalt nummerdatud järjestus (Rimmer ja Van Dulken 1992).

See ülevaade ei püüdnud anda täielikku ülevaadet pärmitehnoloogiast, sest patendid moodustavad vaid murdosa kõigist leiutistest. Seda on käsitletud mujal (Reed ja Nagodawithana 1991 Gélinas 2006). Patente peeti pigem privilegeeritud ja õigeaegseks tõendiks huvide ja murede arengust pärmitootmistööstuses, eriti aastatel 1900–2009. Selle tööga lõpetatakse ka enne 1900. aastat avaldatud patentide ülevaade (Gélinas 2010a). Enamik patente saadi otsingu kaudu andmebaasidest, nagu [email protected] ja Depatis. Mõned Prantsuse patendid telliti INPI (Institut Natl. de la Propriété Intellectuelle, Pariis) kaudu. Täpsemalt on metoodika kohta toodud Gélinas (2010a) . Selle ülevaate valmimise lähedal oli võimalik pääseda juurde Wagneri (1936) avaldatud raamatule, mis sisaldab lühikest kokkuvõtet paljudest enne 1936. aastat pagaripärmi kohta välja antud patentidest.


Valgu ekspressioon

Rekombinantsete valkude ekspressioon, eriti kasutades bakterivektoreid ja peremeesorganisme, on küps tehnoloogia. Sobivate cDNA ja PCR meetoditega saab ekspressiooniplasmiide ​​kiiresti toota. Pärast konstruktide järjestuse määramist transformeeritakse plasmiidid ekspressiooniperemeesteks, valitakse üksikud kolooniad ja viiakse läbi fermentatsioon. Koos E. coli, tekib 2-liitrine kääritamine keeruka söötmega

50–80 g (rakkude märgkaal). Eeldades mõõdukat valgu ekspressiooni (2% kuni 5% raku koguvalgust), on rakkudes saadaval 100 kuni 300 mg rekombinantset valku. Probleem on muidugi selles, kuidas seda aktiivsel kujul isoleerida. Lahustuvad valgud saab kätte hea saagisega (㹐%) ning lahustumatud valgud, mis peavad läbima denaturatsiooni- ja voltimistsükli, saab kätte tagasihoidlikuma saagisega (5% kuni 20%). Seega, kasutades väikesemahulisi fermentatsioone ja laboratoorseid töötlemisseadmeid, saab valke (või nende alamdomeene) tavaliselt toota piisavas koguses (10 kuni 100 mg), et algatada enamik uuringuid, sealhulgas üksikasjalikud struktuursed määramised. Mõned strateegiad geenide kõrgetasemelise ekspressiooni saavutamiseks E. coli on üle vaadanud Markrides (1996) ja Baneyx (1999) ning neid käsitletakse ka peatükis 5.24.

Mõned ülaltoodud omadustest kehtivad ka valkude tootmisel, kasutades pärmi ja bakuloviiruse eukarüootseid ekspressioonisüsteeme, kuigi vektorite konstrueerimiseks ja bakuloviiruse süsteemiga töötlemiseks rakkude tootmiseks on vaja rohkem jõupingutusi ja teadmisi. Pärmi ekspressioonisüsteem võib olla tark valik valkude jaoks, mis moodustavad bakterites lahustumatuid inklusioone, ja membraaniga seotud valkude tootmiseks (Cereghino ja Clegg, 1999 UNITS 5.6𠄵.8). Bakuloviiruse süsteem on osutunud väga kasulikuks fosforüülitud valkude ja glükoproteiinide tootmiseks (Kost, 1999 UNITS 5.4𠄵.5) ning interakteeruvate valkude koosekspressiooniks. Stabiilsete imetajate valgu ekspressioonivektorite konstrueerimine nõuab märkimisväärselt rohkem aega ja vaeva, kuid see võib olla ainus viis keerukate mitmedomeeniliste valkude tootmiseks (UNITS 5.9𠄵.10). Rakud, mis kasvavad rakkude tihedusega 1𠄵 휐 9 rakku/ml, eritavad tavaliselt toodet 㸐 mg/l. Alternatiivina võib väiksemate valgukoguste tootmiseks kasutada transientseid geeniekspressioonisüsteeme, mis kasutavad erinevaid viirusvektoreid (nt vaktsiiniaviiruse UNITS 5.12𠄵.15), mis on kasulik teostatavusuuringute jaoks. Huvitav on märkida, et biotehnoloogiaettevõtted arendavad aktiivselt imetajate rakkude suuremahulisi mööduvaid ekspressioonisüsteeme (Wurm ja Bernard, 1999).

Peremeessüsteemi valikut rekombinantsete valkude tootmiseks käsitletakse peatükis 5.16 ja selle on lühidalt kokku võtnud ka Brondyke (2009). Samuti on ajakirjas eriväljaanne rekombinantsete valkude tootmise kohta Biotehnoloogia edusammud (Sanchez ja Demin, 2012). Selles numbris on suurepärased ülevaated valgu ekspressioonist ja tootmisest E. coli (Chen, 2012) pärm (Celik ja Calik, 2012) putukarakk ja bakuloviiruse süsteem (Drugmand jt 2012), imetajarakud (Zhu, 2012), rakuvabad süsteemid (Carlson et al., 2012) ja taimerakud (Xu et al. ., 2012).

Nagu Chen (2012) mainis, on paljude uurijate jaoks sageli esialgne valik Escherichia coli mis on endiselt eelistatud süsteem laboriuuringuteks ja äritegevuse esialgseks arendamiseks ning on võrdlusaluseks teiste erinevate väljendusplatvormide vahel. See on tingitud sellistest teguritest nagu geneetilise manipuleerimise lihtsus, optimeeritud ekspressiooniplasmiidide kättesaadavus ja kasvu lihtsus. See üksus annab ülevaate rekombinantsete valkude puhastamisest, pöörates erilist tähelepanu valkudele, mida ekspresseeritakse E. coli. Praktilisi aspekte ja strateegiaid rõhutatakse läbivalt ning võimalusel viidatakse arutelule 6. peatüki ülejäänud osas kirjeldatud näidisprotokollidele.

Esimene osa käsitleb teavet, mis on seotud valgu puhastamisega, mida saab tuletada cDNA järjestuse translatsioonist. Sellele järgneb lühike arutelu mõningate levinud probleemide üle, mis on seotud bakteriaalse valgu ekspressiooniga (vt ka ÜKSUS 5.1). Valgu puhastamise strateegia kavandamine nõuab ekspressiooniprodukti lahustuvuse määramist, samuti on kasulik määrata valgu asukoht rakus, nt tsütoplasmas või periplasmas. See üksus sisaldab vooskeeme, mis võtavad kokku lähenemisviisid bakterite poolt toodetud valkude lahustuvuse ja lokaliseerimise määramiseks (vt ka ÜKSUS 5.2).

Nii lahustuvate kui ka lahustumatute valkude puhastamisstrateegiad on üle vaadatud ja kokku võetud vooskeemides (vt ka 1. peatükk). Paljusid üksikuid puhastamisetappe, eriti neid, mis hõlmavad kromatograafiat, käsitletakse üksikasjalikult 8. ja 9. peatükis ning mujal (Scopes, 1994 Janson, 2011). Siin kirjeldatud metoodikad ja käsitlused sobivad sisuliselt laboratoorseteks operatsioonideks. Suuremahulisi metoodikaid on varem üle vaadatud (Asenjo ja Patrick 1990 Thatcher, 1996 Sofer ja Hagel, 1997).

Lisatud on jaotis glükosüülimata olekus bakterites toodetud glükoproteiinide kohta, et rõhutada, et kuigi need ei pruugi olla kasulikud in vivo uuringutes, sobivad sellised valgud hästi struktuuriuuringuteks. Viimased osad käsitlevad valkude käitlemist, puhastamise ulatust ja eesmärke ning rekombinantse valgu puhastamiseks ja iseloomustamiseks vajalikku erivarustust.


Kuidas teaduslik meetod töötab

On selge, et teaduslik meetod on võimas tööriist, kuid sellel on oma piirangud. Need piirangud põhinevad asjaolul, et hüpotees peab olema kontrollitav ja võltsitav ning katsed ja vaatlused on korratavad. See asetab teatud teemad teadusliku meetodi haardeulatusest välja. Teadus ei saa tõestada ega ümber lükata Jumala või mõne muu üleloomuliku olemi olemasolu. Mõnikord kasutatakse teaduslikke põhimõtteid, et püüda usaldusväärsust anda teatud mitteteaduslikele ideedele, näiteks intelligentne disain. Arukas disain on väide, et universumi ja elu päritolu teatud aspekte saab seletada ainult intelligentse, jumaliku jõu kontekstis. Aruka disaini pooldajad püüavad seda kontseptsiooni teadusliku teooriana edasi anda, et muuta see avalike koolide õppekavade arendajatele meeldivamaks. Kuid intelligentne disain ei ole teadus, sest jumaliku olendi olemasolu ei saa katsega kontrollida.

Teadus ei ole ka võimeline väärtushinnanguid andma. Näiteks ei saa öelda, et globaalne soojenemine on halb. See võib uurida globaalse soojenemise põhjuseid ja tagajärgi ning anda nendest tulemustest aru, kuid ei saa väita, et maasturitega sõitmine on vale või et inimesed, kes ei ole tavalisi lambipirne kompaktluminofoorpirnide vastu vahetanud, on vastutustundetud. Mõnikord kasutavad teatud organisatsioonid oma põhjuste edendamiseks teaduslikke andmeid. See hägustab piiri teaduse ja moraali vahel ning julgustab looma "pseudoteadust", mis püüab seadustada toodet või ideed väitega, mida pole rangelt testitud.

Siiski on teaduslik meetod õigesti kasutades üks väärtuslikumaid tööriistu, mille inimesed on kunagi loonud. See aitab meil lahendada igapäevaseid probleeme maja ümber ja samal ajal aitab meil mõista sügavaid küsimusi maailma ja universumi kohta, milles me elame.

Enamasti ei saa ühe nähtuse kirjeldamiseks eksisteerida kahte konkureerivat teooriat. Aga valguse puhul ühest teooriast ei piisa. Paljud katsed toetavad arvamust, et valgus käitub pikilainena. Kokkuvõttes on need katsed andnud aluse valguse laineteooriale. Teised katsed toetavad aga arvamust, et valgus käitub osakesena. Selle asemel, et üks teooria välja visata ja teine ​​alles jätta, säilitavad füüsikud valguse käitumise kirjeldamiseks laine/osakeste duaalsuse.


Mikroorganismide klassifikatsioon | Mikrobioloogia

Järgmised punktid tõstavad esile mikroorganismide kolm peamist klassifikatsioonisüsteemi. Klassifikatsioonisüsteem on: 1. Viie Kuningriigi klassifikatsioonisüsteem 2. Kaheksa kuningriigi klassifikatsioonisüsteem 3. Kolme domeeni klassifikatsioonisüsteem.

1. Viie kuningriigi klassifikaatorite süsteem:

Hiljem eristati raku anatoomia põhjal prokarüootsed ja eukarüootsed organismid ning bakteri kui prokarüootse organismi kontseptsiooni kehtestasid mikrobioloogias 1962. aastal Stamir ja Van Niel. 1969. aastal pakkus Whittaker välja viie kuningriigi süsteemi, mis koosneb taimede, seente, loomade, protistade ja monera kuningriigist (joonis 2.3) kõigi organismide jaoks nende energiat tootvate süsteemide ja raku anatoomia alusel.

Ülalkirjeldatud ühiste tunnustega mikroorganismid on levinud monera, protista, seente ja osa taimedest. Hiljuti on ribosomaalsete RNA järjestuste ja muude andmete põhjal määratletud elusorganismide evolutsioonilised suhted.

Prokarüootsete Monera kuningriiki kuuluvad kõik prokarüootsed mikroorganismid. Protista koosneb ühe- või mitmerakulistest eukarüootsetest organismidest, kuid puuduvad tõelised kuded. Seente kuningriik sisaldab eukarüootseid ja mitmetuumalisi organisme.

Liikmetel on imenduv toitumisviis. Animalia sisaldab mitmerakulisi loomi, kellel puudub rakuseina. Allaneelamine on toitumisviis. Plantae kuningriiki kuuluvad mitmerakulised eukarüootid. Nende toitumisviis on fotosüntees.

2. Kaheksa kuningriigi klassifitseerimis- ja varjutamissüsteem:

Cavalier-Smith (1987, 1993) liigitas protistid rakkude ja geneetiliste organisatsioonide ultrastruktuuri (rRNA sekveneerimine ja muud andmed) alusel kaheksa kuningriiki. Ta jagas kõik organismid kaheks impeeriumiks (bakterid ja eukarüootid) (joonis 2.4). Bakterite impeerium hõlmab kahte kuningriiki (eubakterid ja arheobakterid). Eukaryota impeerium sisaldab kuut kuningriiki (arhezoa, algloomad, taimed, kromistad, seened ja loomad).

Chromista kuningriiki kuuluvad ränivetikad, pruunvetikad, krüptomonaadid ja oomütseedid. Chromista liikmed on fotosünteetilised ja nende kromoplast paikneb endoplasmaatilise retikulumi luumenis, kuid mitte tsütoplasmas.

3. Kolme domeeni klassifikatsioonisüsteem:

Woese (1990) märkis, et bakterid on taimedest ja loomadest kaugel ning seevastu taimed ja loomad pole üksteisest nii kaugel. Seetõttu kehtestasid nad kuningriigist uue kõrgema domeenide kontseptsiooni ja pakkusid 1991. aastal välja kolm domeeni – Bakterid, Arhea ja Eukarya (joonis 2.5).

Joonis 2.5: Universaalne fülogeneetiline puu, mis on saadud 16S või 18S ribosomaalse RNA võrdlevast sekveneerimisest.

Domeenid Archaea ja Eukarya on üksteisega selgelt seotud. Eukarya hõlmab organisme, mis sisaldavad glütserooli rasvatsüüldiestrit membraani lipiididena ja eukarüootset rRNA-d. Domeen Bakterid koosneb sellistest liikmetest, millel on membraani lipiidid nagu diatsüülglütserooldiestrid ja eubakteriaalne rRNA.

Domeeni Archaea mem­ber koosneb isoprenoidsetest glütserooldiestri (või diglütserooltetraeetri) lipiididest nende membraanis ja arhebakteriaalses rRNA-s.

Kaasaegses mõistes on bakterid, tsüanobakterid, aktinomütseedid jm jaotunud domeenis bakterid metanogeenid äärmiselt termofiilsed organismid, äärmiselt halofiilsed organismid jne on domeenis Archaea ning hallitusseened, pärmid, basidiomütseedid, vetikad ja algloomad jne. domeen Eukarya. Mikroorganisme peetakse erinevate evolutsiooniliste organismide kogumikeks.


Viige see kindlasse kohta

Kui pudel oli täielikult täitunud, viisime kogu pärmisuhkru katse kraanikaussi. Mullid liikusid aeglaselt ja meil polnud millegi pärast muretseda, kuid N nautis õhupalli maha tõmbamist ja vaatamist, kuidas vaht aeglaselt pudeli pealispinnale kallas.


Materjalid ja meetodid

Maksimaalse tõenäosusega sobitamise protseduur (joonis 2D) rakendati MATLABis ja lähtekood on saadaval aadressil https://github.com/gerland-group/PHO5_on-off-slide_models.

Maksimaalne tõenäosus sobib

Sõltuvalt analüüsi etapist optimeerisime parameetrite väärtusi, st antud mudeli protsesside kiirusväärtusi r → , maksimeerides log10 tõenäosusväärtuste summa: LI ⁢ ( r → ) etapis 1, LI(r →) + LI⁢I⁢(r →) etapis 2 ja LI(r →) + LI⁢I⁢(r →) + LI⁢I⁢I⁢(r →) etapis 3. Märkus. et optimaalne r → võib eri etappidel erineda. Ignoreerisime logitõenäosuse liitkonstandid, nii et pärast järgmise andmehulga lisamist sobitusse tooks mudeli ja täiendava andmekogumi täiuslik kokkulangevus juba eelmise etapi väärtustega r → sama logaritmi tõenäosuse. väärtus nagu varem. Kõigis etappides kasutasime funktsiooni MATLAB fmincon, et leida parameetri väärtused r →, mis suurendavad tõenäosust.

Joonisel 2 toodud kiiruse parameetri tähistusega on meil näiteks joonisel 3A:

Olgu Q ⁢ ( r → σ ) Markovi protsessi üleminekukiiruse maatriks, mis on määratletud promootori oleku σ mudeliga, kus r → σ tähistab vektorit, mis sisaldab promootori oleku σ reguleeritud parameetri väärtust (väärtusi) ja kõiki parameetrite konstitutiivseid väärtusi . Mittediagonaalne sisestus Q i ⁢ j ⁢ ( r → σ ) on kiirus, mis läheb konfiguratsioonist i konfiguratsiooni j ja on nullist erinev ainult kehtivate monteerimis-, lahtivõtmis- ja libisemisreaktsioonide korral ning seejärel antakse sisestusena r → σ mis sisaldab antud mudelis seda reaktsiooni reguleeriva protsessi parameetri väärtust. Kui libisemisreaktsioone ei reguleeri mudelis ükski libisemisprotsess, määratakse nende kiirus nulliks. Diagonaalkirjed on antud Q i ⁢ i ⁢ ( r → σ ) = - ∑ j ≠ i Q i ⁢ j ⁢ ( r → σ ) . Joonisel 3A kujutatud näites on aktiveeritud olekus üleminekukiiruse maatriks antud (kus ' … ' tähistab diagonaalseid kirjeid)

Q⁢ (r → σ) püsiseisundi jaotus p i⁢ σ on p j ⁢ σ = ∑ i p i ⁢ σ ⁢ Q i ⁢ j ⁢ ( r → σ ) = 0 lahendus.

Siis saab L I ⁢ ( r → ) arvutada multinominaaljaotuse abil,

kusjuures n i σ on vastavate promootori konfiguratsioonide vaatluste arv (joonis 1 – lähteandmed 1).

Iga mudeli puhul kasutasime tugeva maksimumi tagamiseks 100 erinevat algparameetrite väärtuste komplekti. Antud mudeli püsiseisundi jaotuse arvutamiseks fikseeritud parameetrite väärtuste puhul kasutasime oleku vähendamise algoritmi (Sheskin, 1985 Grassmann et al., 1985 Shanbhag ja Rao, 2003). Alternatiivina saab Markovi protsesside püsiseisundi jaotuste leidmiseks kasutada maatriksi-puu teoreemi (Wong ja Gunawardena, 2020). Piirasime parameetrite väärtuste vahemikku [10-2 10 2], millest üks oli aktiveeritud oleku globaalse koosteprotsessi kiirusväärtus. Laiem vahemik [10-3 10 3] tulemusi ei mõjutanud. 3,6% kõigist mudelitest leiti 100 katsega vähemalt kaks erinevat maksimaalse tõenäosuse väärtust, mis olid alati äärmiselt madalad. 2,4% kõigist mudelitest ei olnud leitud maksimaalse tõenäosuse parameetrite väärtused ainulaadsed. Mõlemal juhul ei kuulunud ükski neist probleemsetest mudelitest suhteliselt kõrge maksimaalse tõenäosusega mudelite hulka.

2. etapis optimeeritakse LI (r → ) ja L I ⁢ (r → ) summa. Eeldades, et eksperimentaalsed voltimismuutused on tavaliselt jaotunud, annab mudeli log10 tõenäosuse reprodutseerida uusi andmeid kuni aditiivse konstandini

kus fsm keskmine ja fsmvar on vastavalt keskmine ja dispersioon kleepuva N-3 mutandi m aktiivses olekus mõõdetud ligipääsetavuse kordades muutustest nukleosoomi saidis s (kaks N-2 ja 3 N-3 puhul) , fs ⁢ ( r → , κ → m ) on vastav mudeli kordne muutus ja κ → m on kleepuva mutandi m kiiruse prefaktorite väärtused.

Iga mudeli fs⁢ (r → , κ → m) saamiseks arvutasime iga mutandi jaoks modifitseeritud üleminekukiiruse maatriksi, kasutades üleminekukiiruse maatriksi Q⁢ mittediagonaalset osa (r → act ) ja korrutasime selle komponentide kaupa. maatriksiga W ( κ → m ), mis sisaldab prefaktori väärtusi κ → m mutandi m mõjutatud reaktsioonide jaoks (ja üks muul viisil). Modifitseeritud üleminekukiiruse maatriksite abil arvutasime välja mutantide püsiseisundi jaotused ja lõpuks ligipääsetavuse vastavad kordamissuhted N-2 ja N-3 juures.

Kasutasime nelja prefaktorit kleepuva N-3 mutandi kohta, ühte iga reaktsioonirühma jaoks, kokkupanemist N-3 juures, lahtivõtmist N-3 juures, libisemist N-3-lt N-2-le ja N-2-lt N-3-le (joonis). 2 – joonise lisand 5), mis annab vastavalt κ → m = ( κ a 3 m, κ d 3 m, κ s 23 m, κ s 32 m) ⊤ . W ⁢ ( κ → m ) diagonaaliväline osa on siis antud

kus diagonaal ei oma tähtsust komponentide kaupa korrutamisel Q ⁢ ( r → act ) mittediagonaalse osaga, et saada mutantkiiruse üleminekumaatriksite mittediagonaalne osa. Seega sõltub L I⁢ I ainult r → tegu . Pange tähele, et optimeerimise käigus leitud prefaktorite täpsed väärtused sõltusid nende algseisundist, kuna nende parimad väärtused olid sageli lohakad või mitte ainulaadsed, kuid andsid siiski tulemuseks maksimaalse tõenäosuse.

3. etapi jaoks on L I⁢ I'l kaks panust, üks iga histooni H3 vahetuskatse jaoks:

Rangelt võttes sõltub L I⁢ I I ainult r → rep , kuna kõik histooni H3 vahetuskatsed viidi läbi represseeritud olekus. Esimese panuse jaoks kasutasime Rufiange et al., 2007 andmete sobitamiseks

g keskmine ja g var on vastavalt mõõdetud Flag koguste N-1 ja N-2 log2 suhte keskmine ja dispersioon (Flag-H3 MNase-ChIP, Rufiange et al., 2007, suhte väärtused 0,591 ja 0,483 replikatsiooni 1 ja 2 jaoks vastavalt) ja g ⁢ ( r → , t ′ ) mudeli vastav log2 suhe (vt materjalid ja meetodid: H3 histoonivahetuse mudel) mõõtmisaja jaoks t ′ = 2 h (ei ole korrigeeritud viivitusaeg).

Teise panuse puhul olgu h j keskmine tähistab mõõdetud normaliseeritud keskmist log2 suhet Flag summa ja Myc summa kohta N-1 juures, kusjuures j = 1 , 2 , 3 , 4 näitavad nelja erinevat ajapunkti. Saime h → keskmine = (-0,417, 1,24, 1,87, 2,60) ⊤ (Dion et al., 2007) järgmiselt: arvutasime iga ajapunkti normaliseerimiskonstandi ümber, kasutades mõõdetud keskmist log2 Myc/Flag signaali suhet, nagu kirjeldatud (täiendav Dion et al., 2007 materjali, kasutades kogu genoomi kaubanduslikke mikrokiipe (Agilent) andmeid koos nukleosoomide kogumi parameetritega, nagu ülaltoodud jaotises), ja seejärel võeti sondi normaliseeritud tulemused asendis N-1 PHO5 promootor (chr2:431049–431108). Kahjuks olid naabersondid ainult promootori nukleosoomi positsioonide vahel asuvates linkeripiirkondades. Nagu mainisid Dion et al., 2007 ja mida kinnitavad ka meie enda arvutused, on h j keskmiste väärtustel suur ebamäärasus, mis on peamiselt tingitud aditiivsest lohakast globaalsest normaliseerimiskonstandist, mis põhjustab süstemaatilisi vigu, samas kui ajapunktide vahelised erinevused määrati mõistliku täpsusega. Seega otsustasime mõõdetud väärtused sobitada alles pärast teisendust, mis kõrvaldab lohaka globaalse normaliseerimiskonstandi, valides võrdlusaluseks nelja ajapunkti keskmise: h

j keskmine = h j keskmine - 1 / 4 ⁢ ∑ k = 1 4 h k keskmine . Let C be the resulting covariance matrix after this linear transformation, assuming an independent estimated experimental standard deviation of 0.4 before the transformation. This estimate was informed by the standard deviation of the Rufiange et al., 2007 data as well as from perturbations of the nucleosome pool parameters when recalculating the normalization constants. The corresponding normalized values of the model are denoted by h

j ⁢ ( r → ) , calculated from the log2 ratios of Flag amount over Myc amount at N-1, h ⁢ ( r → , t j ) (see Materials and methods section: H3 histone exchange model), using the same transformation, with t j denoting the measurement time points. Since the four measurements at different time points were linearly mapped to always have an average of zero, the estimated density follows a degenerate multivariate normal distribution with the covariance matrix C . Thus the log10 likelihood can be calculated with

where C + is the Moore-Penrose inverse (pseudoinverse) of C .

H3 histone exchange model

To obtain the Flag and Myc amounts in a given model with given parameter values and then determine g ⁢ ( r → , t ′ ) and h ⁢ ( r → , t j ) , we used the histone pool and nucleosome turnover models in Dion et al., 2007 and assumed that the Myc H3 and Flag H3 amounts in the histone pool are given by M ( t ) = α M β M and

where we used the production rates α F = 50 / min , α M = 10 / min , the degradation rates β F = 0.01 / min , β M = 0.03 / min and the lag time t 0 = 15 min which were fitted in Dion et al., 2007. For t > t 0 , the probability that a newly assembled nucleosome contains a Flag H3 is given by

In Dion et al., 2007, the conditional probability that a given nucleosome at site l at time t contains a Flag H3 then fulfills the ordinary differential equation

with λ l being an effective turnover rate at probe position l . In our case, the dynamics of the three promoter nucleosomes are coupled, determined by the transition rate matrix Q ⁢ ( r → σ ) of a given regulated on-off-slide model. At this stage, we included different nucleosome types (i.e. Flag and Myc) into the model, replacing the eight promoter configurations by all 27 possibilities to arrange no, a Flag or a Myc nucleosome at each of the three sites. Based on Q ⁢ ( r → σ ) and P + ⁢ ( t | N ) , we define an extended Flag/Myc transition rate matrix E ⁢ ( r → σ , P + ⁢ ( t | N ) ) . Each ‘new’ assembly reaction rate in E ⁢ ( r → σ , P + ⁢ ( t | N ) ) is given by the corresponding ‘old’ assembly rate in Q ⁢ ( r → σ ) times either P + ⁢ ( t | N ) or 1 - P + ⁢ ( t | N ) , for a new Flag or Myc nucleosome, respectively. To find the corresponding ‘old’ reaction any extended Flag/Myc configuration is projected to one of the eight normal nucleosome configurations simply by ignoring the Flag/Myc tag information. For example, denoting Flag- and Myc-tagged nucleosomes with ‘F’ and ‘M’, respectively, an assembly reaction from the state (F, M, 0) to the state (F, M, M) in the extended model corresponds to an assembly reaction from state (1, 1, 0) to the state (1, 1, 1) in the normal model, and its reaction rate is multiplied by 1 - P + ⁢ ( t | N ) in the extended model, since the new nucleosome is Myc-tagged. The rates of sliding and disassembly of Flag or Myc nucleosomes are assumed to be equal to the corresponding normal sliding and disassembly rates. The probability of extended configuration i at time t is the i -th entry of q → * ⁢ ( t ) , the solution of

where σ is fixed in the repressed state, in which all histone exchange experiments took place. The log2 ratios of Flag at N-1 over Flag at N-2 amount, g ⁢ ( r → , t ) , and Flag over Myc amounts at N-1, h ⁢ ( r → , t ) , of each model then correspond to log2 ratios of sums of q i * ⁢ ( t ) over suitable configurations i with Flag or Myc nucleosomes at the wanted sites.

Sensitivity analysis

In order to determine how sloppy the found best parameter values for a given model are, we performed a simple sensitivity analysis, by calculating the log10 likelihood L I + L I ⁢ I + L I ⁢ I ⁢ I along certain directions from the best fit point in logarithmic parameter space. We found that an approximation of the real likelihood function by a second-order Taylor expansion at the best fit point worked only in a small area, as expected in a highly non-linear setting, but too small to determine parameter sloppiness properly.

As a compromise between properly scanning the parameter space and computational feasibility, we chose a small number of test directions: each fitted parameter value individually, the eigenvectors of the numerical Hessian of the likelihood function at the best fit, as well as the numerical gradient, which can be non-zero if the best fit point lies on the boundary. We ignored the boundary during the sensitivity analysis, to also take into account sloppiness that 'reaches over’ the boundary. Along these directions, we tested in exponentially increasing steps from the best fit position which positions in parameter space lead to a decrease of the likelihood by ≈ 50 % , that is, a log10 likelihood ratio change of ≈ 0.30 , which is of similar order as the log10 likelihood differences within our group of satisfactory models. We then obtained 'error bars’ for each parameter by taking the largest deviation of the log10 parameter value at the 50% likelihood level from the best value found in all tested directions (Figure 4—source data 1 and Figure 4—source data 2).

Effective chromatin opening and closing rates

The effective trajectory in time of the regulated process rate from the value of the repressed state to the value of the activated state depends on how fast the cell senses the phosphate starvation and subsequent signal processes. To obtain a reasonable upper bound for the chromatin opening rate, we assumed the regulation happens instantaneously, that is, the activated rate value of the regulated processes applies immediately at the change of the medium for a population in repressed state. Then the promoter configuration distribution decays exponentially toward the activated steady state with a rate well approximated by the negative eigenvalue of the transition rate matrix closest (but not equal) to zero, taking into account the fitted time scale. This ‘effective chromatin opening rate’ is an upper bound of how fast a given model can switch to the activated state. Conversely, we did the same calculations for the ‘effective chromatin closing rate’, which is an upper bound of how fast a given model can switch to the repressed state.

Sticky N-3 experiments

Strains 'sticky N-3 mutant 1’ and 'sticky N-3 mutant 2’ used for restriction enzyme accessibility assays were generated by transformation of linear fragments of plasmids ECS53 and ECS56, respectively, into the wild type strain BY4741 as described for the 'periodicity mutants’ in Small et al., 2014. For the sticky N-3 mutant 1, the sequence GTTTTCTCATGTAAGCGGACGTCGTC inside the PHO5 promoter was replaced with GTTTTCTTATGTAAGCTTACGTCGTC . For sticky N-3 mutant 2, GCGCAAATATGTCAACGTATTTGGAAG was replaced with GCGCAAATATGTCAAAGTATTTGGAAG . Strains were grown in YPDA medium to logarithmic phase for repressive (+Pi) and shifted from logarithmic phase to phosphate-free YNB medium (Formedia) over night for inducing (-Pi) conditions. Nuclei preparation, restriction enzyme digestion, DNA purification, secondary digest, agarose gel electrophoresis, Southern blotting, hybridization, and Phosphorimager analysis were as in Musladin et al., 2014. Secondary digest was with HaeIII for both ClaI and HhaI digests probing N-2 or N-3, respectively. The probe for both ClaI and HhaI digests corresponded to the ApaI-BamHI restriction fragment upstream of N-3.